General Directions for FASTA format

Full genetic sequences are commonly stored in FASTA format which contains a listing of each nucleotide in the sequence. If you have had your mtDNA sequenced, your testing service (FTDNA, et al.) will usually provide you with your results in FASTA format (and in a shorthand of differences to rCRS which mthap can also use). You can also download public mtDNA sequences from places like GenBank in FASTA format. A FASTA file will look something like this:

>gi|296801958|gb|HM246245.1| Homo sapiens haplogroup U5a2a mitochondrion, complete genome
GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGG
GTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTC
CTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTA
...(lots more lines)...

(The first line is typically a comment line describing the sequence and there's no set format required other than it start with ">".)

Please make note of the following:

• mthap will ignore any lines which have any non-nucleotide characters.
• Heteroplasmy should use the single letter format: Y, not [C/T].
• All "N" nucleotides will be ignored to handle the 3107N convention; this is not currently positional.
• Sequences must be of nucleotides, not amino acid codons.
• The sequence must contain a complete mtDNA sequence, but it is OK if only HVR1 or HVR1+HVR2 have been sequenced (CR should be copied from rCRS).
• Handling of insertions/deletions may vary from other conventions. Please keep this in mind when interpreting your results.
• Alignment will take a few extra seconds depending on the complexity of the sequence. Please be patient.

Brief directions for FTDNA users:

1. Log into your account.
2. On the top of your "myFTDNA Home" page look for the "mtDNA" section and click on "Results."
3. Scroll to the bottom of the page and click on the orange "FASTA" button in the bottom right corner of the page.
4. Save the fasta file somewhere on your computer.
5. Click on the "Browse" button on the mthap page and select the fasta file.
6. Click on "Upload."